Apidb Usability Conference

Database Usability Exercises


The next few questions are designed to help us understand where we need to make our databases more intuitive and provide more instructions/tutorials. We are more interested at this stage in how you try to answer the question than the answer itself. Please discuss your thoughts and strategy out loud so we can understand what you are thinking as you try to find the answers.

For example. If the question asks you to find the version number for the current release of one of the databases, your attempt to answer this question might sound like "OK, they must post this information somewhere. Maybe it is on the Front page somewhere, or in the Useful links, or datasource. Hmm. let's look at the useful information first....." We want to know where you would intuitively and naturally go to find particular types of data or information and why. This will help us to design a use interface that easier to more intuitive for you the user.

The Questions:


1) Perform a BLASTX search at one of the ApiDB databases (ApiDB.org, CryptoDB.org, PlasmoDB.org or ToxoDB.org) with the sequence below. Are you able to identify it? You can use the cut and paste functions of your browser to get the sequence and use it for the BLAST search.

ATGAAGCTCGTTTTTCCTGCCGTTTGCGTCGTGGCTCTGTCGTCGGAGACGTTGCTCAAA CTAGCGTTGGGGAACCCTGGAGTGCCTCCTGTGCCATCATGCCCACCGGGTTTTTCGTTG GAACAAAGAGGATGCGTGAGGTCCAGACAAGTTCCACCCATTATGCGGTGCGCGAAAAAG TCGGTTTTGGCGGGAAACGAATGCGTGACAACTGAGTTTGCTCCCAGCATCGAGGTCTGC CCTGAGGGCTTCATCGAGAAGAACCGCAAGTGCCGGAGAGTCGTAAACGCCCAACCGCAG CTGGGCTGTAAACCGGGGTTTACCCTTCAGAACGGCGGCGACTGCATCCGAGTCACAGAA GACGACATTATCACGCGATGCCCCCCTAAGAGCAAGCACACAAGCAAGGGATGTGTGACC GTGGAGAAACTCGATGTCGTTCCCAGCTGTCCACGAGGCTACGAGCTAAAGAAGAATGCG TGTATCATGACTCAGAATATCGAACCAGTGCCTTCTTGTCCTCAAGGATTCGCCTTCGAA AGTGGCGCGTGCGTCCGCACGGGTGCAGTGCCGCCTAGAGTCTCGTGCCCTAGAGGGTAC AAACGACAAGACAACGGATGTGTACTCTTCGAGAAGCACGACCTCGAAGCCTTCTGCCGG GATGGGGAATATGACGGGAAAAAACACTGCCGGAAAACTACGACGCAGCCAGCGCTTCCG CACTGCCCTGCTGGGTTCTCGTTCCAGAACGGAGAGTGCGTCCGAGTCCAGGAGGACATT GCTAGGTTGGAGTGTGGTAAAGGATTTACCCTGCATGAGGACAGGTGTGTGAAGGAGGTG ACGGTCGCGGCGGAACTTCAGTGTCCGCCCGGTGCGACGTTGATGAAAGACAAATGCGCG ATTTTGACAAGCGAGAAACCTGCGGTTACGTGTCCAGATAAGTTTATAATGGCGGACGGG GTGTGCAAAAGCGCAGACGTGCGACCTGCTGAGTTTGTCTGCCCCAAGGGCTATACAATG GACAGAGGCACTGGGGGCTGCGTCCGGTCTACCACAGCAAAACCTGCCCTTTCGTGTGAG CGTGGTGAACTGAAAAAAGGCGAGTGTTCGATGATCCAGACTGTTCCCGCAGAAACCGCC TGCATCTTGGGCGGAGCGCTGACCCCTGACGGATGTGTGTTCATCGACACGGCGCCTCTC AGCCACCGATGTGGTGCAAATTTCAAAATGGACATCAAGGGTCAGTGCGCGACAGTCGAG ACGATCGACCCCGAACACATTTGCCCCCCCGGCTTTGCTCCCTCCGGAACCAAAAAAGCC ACATGTGAAAGGTTTCTGACTTCACCGGCGGCGATCAAGTGCCCTGCAGGCTTCGAGCCT GCCGGCACCAAGTGCATGAAAACGGCGCGCATCCAAGCCATCGCCTCTTGCCCCCACGGG TTTGTTTTCCACGAAGGGGCGTGCATCCCGTACAAAGCCAACGGCAAAAAGAAGCTCTAG

2) How many proteins are annotated as serine/threonine kinases in ToxoDB?

3) How many annotated proteins in ToxoDB have a signal peptide and at least one transmembrane domain?

4) How many tRNA genes are annotated in Cryptosporidium hominis?

5) You have discovered a new protein family in your favorite apicomplexan organism. All members of the protein family have the following amino acid motif CCCXC where C= Cysteine and X=anything. Please visit the database of at least one other apicomplexan organisms and see if you can find members of this protein family by searching for this motif. Hint, this motif is too small to use in a BLAST search. Also, consider searching not only the annotated genes but also ORFs.

6) You want to study the promoter regions of the var genes in Plasmodium falciparum. To do this, you need to study the 1,000 nt upsteam of all annotated var genes. These genes encode the pfemp1 protein family of variant surface antigens. Visit PlasmoDB to generate and obtain this data set, i.e. download a file of the upstream regions.